genetika 2

Genetické příčiny percepčních sluchových vad

27.2.2017

Co to vlastně znamená „genetická ztráta sluchu“? Jak se projevuje? Co je Connexin 26 a jakým způsobem ovlivňuje sluch? Na tyto otázky se pokusíme v následujících odstavcích odpovědět.

PROČ DĚTI ŠPATNĚ SLYŠÍ?

Slyšení je velmi komplexní proces, a proto i příčin poruch sluchu existuje celá řada. Část sluchových vad je způsobena vnějšími příčinami, podle různých studií 40-50%, část dědičnými – 50-60%. Vnější příčiny mohou působit již v těhotenství, obvykle při infekci matky. Ototoxická, tedy sluch poškozující, mohou být i některá v těhotenství podávaná antibiotika. Vnější příčiny mohou působit i v období kolem porodu, nejčastěji u dětí s velmi malou porodní hmotností nebo dětí s poporodní asfyxií (nedostatek kyslíku). Po porodu může dojít k poškození vláskových buněk hlemýždě vlivem infekce, především meningitidy, nebo v důsledku užívání některých typů ototoxických antibiotik.

Příčinou dědičných sluchových vad jsou genetické poruchy. Mohlo by se zdát, že genetická příčina je možná jen tehdy, když se v rodině někdy hluchota vyskytla, ale není to pravda. Jsou velice časté případy, kdy dítě má genetickou ztrátu sluchu, ačkoli se tento problém v rodině nikdy nevyskytl. Tento typ sluchové poruchy může být pak předán i do dalších generací. V následujících řádcích se pokusíme vysvětlit mechanismy, kterými k přenosu genetické poruchy sluchu dochází.

Genetická porucha sluchu může být syndromová nebo nesyndromová. V případě syndromové poruchy – u 20-30% dědičných hluchot - je vada sluchu pouze jedním z několika dalších příznaků a zdravotních problémů, je součástí celého syndromu. Syndromů spojených se sluchovým postižením je popsáno asi 100. Mezi relativně časté patří např. CHARGE syndrom, Usherův syndrom, Pendredův syndrom a další. Mnohem častější – 70-80% dědičných hluchot - jsou genetické vady sluchu nesyndromové, kterými se budeme v textu zabývat.

JAK JE GENETICKÁ PORUCHA PŘENÁŠENA?

Více než polovina všech časných sluchových vad u dětí je způsobena dědičnými, genetickými faktory, tedy poruchami genů, které jsou přenášeny v rodině a které ovlivňují vývoj slyšení u dítěte. Všechny geny v lidském těle jsou tvořeny z deoxyribonukleové kyseliny, tzv. DNA. Ta je celá složena ze 4 základních stavebních bází: adeninu (A), cytosinu (C), guaninu (G) a thymidinu (T). Tyto báze se na sebe navazují v mnoha složitých kombinacích, a vytvářejí tak jedinečné sekvence DNA. Geny tvořené úseky DNA určují, jak bude naše tělo vypadat a jak bude fungovat. Určitá malá část nějakého genu může mít například sekvenci bází vypadající následovně: ATTCTGATTTAAGCTA.

Každý člověk má zhruba 30 000 různých genů, které jsou spojeny v útvarech nazývajících se chromozómy. Lidé mají 23 párů chromozómů. Každý pár se skládá z chromozómu zděděného od matky a z chromozómu zděděného od otce. Protože lidské tělo obsahuje dvě kopie každého chromozómu, obsahuje i dvě kopie každého jednotlivého genu, sekvence DNA v nich je víceméně u každého stejná. Přesto se někdy stane, že porovnáme-li sekvenci DNA konkrétního člověka s obvyklou sekvencí, najdeme rozdíl. Této změně v DNA se říká mutace. Některé mutace nijak neovlivňují zdraví svého nositele, jiné natolik ovlivní činnost genu, že se to nějakým způsobem projeví. Toto je například jedna z mutací, ovlivňujících sluch, výměna báze G za bází T stačí k negativnímu ovlivnění sluchu:

AGATGAGCA           normální sekvence = funkční gen = normální sluch

AGATTAGCA            mutace = nefunkční gen = poškozený sluch

Mutace mohou být dominantní nebo recesivní. Pokud stačí jeden pozměněný gen v páru chromozómů, aby negativně ovlivnil vývoj sluchu, jedná se o gen dominantní. Pokud například matka předá svému dítěti gen s dominantní mutací, bude sluch dítěte ovlivněn, i když kopie genu od otce bude zcela v pořádku. Dalo by se to říci i tak, že pozměněná kopie matky je „silnější“, „má větší váhu“, než zdravá kopie od otce. Matka s dominantní mutací v genu nutném pro normální sluch bude sama mít sluchovou vadu.

                                                                                                                               ilustrační foto/Shutterstock

RECESIVNÍ DĚDIČNOST SLUCHOVÝCH VAD

Recesivní mutace jsou u genetických vad sluchu mnohem častější – 80-90% - než mutace dominantní. V tomto případě pozměněný gen sám o sobě nedokáže negativně ovlivnit sluch člověka, který má v páru současně druhý nepozměněný gen. Aby se sluchová vada projevila, musí tento člověk zdědit pozměněné oba geny z páru.

Jako nosič/heterozygot mutace je označován ten, kdo má jeden nezměněný gen a jeden gen s recesivní mutací, a u koho se tedy sluchová vada sama nijak neprojeví, ale kdo ji přitom může předávat svým potomkům. Přenos recesivní mutace od slyšících rodičů na jejich děti je znázorněn na obrázku. Obrázek ukazuje všechny čtyři možné způsoby, jak se páry genu rodičů mohou zkombinovat v genetické výbavě jejich dětí. Jedná se samozřejmě o gen, který je nezbytný pro normální sluch dítěte.

Protože rodiče jsou slyšící, mají každý jeden gen zdravý a jeden gen poškozený, jsou tedy nosiči/heterozygoti recesivního genu. Z obrázku je vidět, že s pravděpodobností 1:4 (25 %) se jim narodí dítě s oběma mutacemi - homozygot, tedy s vadou sluchu. S pravděpodobností 50% budou jejich děti slyšící, ale nosiči téže mutace, tedy také heterozygoti. S 25% pravděpodobností bude potomek těchto rodičů slyšící a nebude přitom nosič mutace genu.

Uvedené procentní údaje jsou pouze pravděpodobnostní, statistické a platí pouze, pokud bychom sledovali velké množství rodičů heterozygotů a jejich dětí. V jedné konkrétní rodině se rodičům nosičům mohou narodit třeba tři děti, z nichž slyší všechny, a jen jedno je také nosič mutace. Naopak se stejným rodičům mohou narodit čtyři děti, které budou všechny homozygoti mutace genu a všechny budou mít sluch poškozen.

CO JE CONNEXIN 26?

Connexin 26 (Cx26) je bílkovina, jejíž tvorba je kódována genem GJB2. Tato bílkovina je zodpovědná za vytvoření systému kanálků - tzv. „gap junctions“ – v plazmatické membráně jednotlivých buněk. Tyto struktury zajišťují prostupnost malých molekul mezi buňkami. Nepřítomnost tohoto systému kanálků pravděpodobně znemožňuje výměnu draslíkových iontů mezi buňkami vnitřního ucha, což je proces nezbytný pro správnou funkci hlemýždě, a tedy pro vznik sluchového vjemu.

JAK SOUVISÍ CX26 S HLUCHOTOU?

Mutace v genu GJB2 jsou nejčastější příčinou dědičné hluchoty. Jsou zodpovědné za cca polovinu recesivně přenášených nesyndromových sluchových vad. Ačkoliv mutace Cx26 mohou být zděděny recesivně i dominantně, naprostá většina z nich se projevuje recesivně. V naprosté většině případů není porucha na GJB2 spojena s žádným dalším klinickým příznakem, výjimku tvoří jeden typ dominantní mutace Cx26, který je spojován s kožním onemocněním palmoplantar keratoderma.

JAK PŘESNĚ V HLENÝŽDI PROBÍHÁ PŘEMĚNA AKUSTICKÉHO PODNĚTU NA NERVOVÝ VZRUCH A JAK SE NA TOM PODÍLÍ CONNEXIN?

Zvuková vlna je zachycena boltcem a rozkmitá pružný bubínek. Přes systém tří středoušních kůstek je akustický signál dále zesílen a přenesen na oválné okénko. To odděluje středouší od vnitřního ucha a má výrazně menší plochu než bubínek. Kmitání oválného okénka je proto na menší ploše intenzivnější a rozpohybuje endolymfu, tekutinu uvnitř hlemýždě.

Závity hlemýždě jsou podélně rozděleny na tři části – scala tympani, scala media a scala vestibuli. Pro vysvětlení mechanismu přenosu zvuku na elektrický nervový vzruch je nejdůležitější scala media, ke které přiléhají vláskové buňky. Scala media obsahuje tekutinu zvanou endolymfa, která je pozoruhodná zejména vysokou koncentrací draslíku. Na jednu kostěnou stěnu scala media přiléhá tzv. stria vascularis, třívrstevný epitel, který zajišťuje transport draslíku do scala media.

Jakmile pohyb endolymfy způsobený kmitáním oválného okénka ohne vláskovou buňku, tímto ohnutím se otevře iontový kanál a do nitra buňky vstoupí draslíkové ionty. Po nahnání draslíkových iontů do buňky dojde k její depolarizaci. Na spodině vláskové buňky je záporně nabitá aminokyselina glutamát, která působí již přímo na vlákna sluchového nervu. Vznikne elektrický potenciál a nervem je veden nervový vzruch, vnímaný pak ve sluchovém centru mozku jako zvuk.

Nyní je třeba draslíkové ionty transportovat zpět do stria vascularis, odkud jsou pak přeneseny zpět do scala media. Vláskové buňky obsahují systém. „gap junctions“, kterým proudí draslíkové ionty zpět do stria vascularis. Protein connexin je podkladem právě pro vznik těchto gap junctions, kanálků, kterými je draslík odčerpáván zpět do prostoru scala media.

                                                                                                                               ilustrační foto/Shutterstock

RŮZNÉ MUTACE GENU GJB2

Poruchy genu GJB2 mohou být umístěné v jeho různých částech, do značné míry je místo – lokace poruchy dáno geograficky. V Evropě převažuje mutace 35delG, vyskytuje se ve více než 70% případů poruchy genu GJB2. V Asii se naopak delece 35delG prakticky nevyskytuje a je zde obvyklá zcela jiná delece genu GJB2. 35delG se nazývá proto, že na 35. místě v sekvenci genu GJB2 chybí (DELeted) báze G (guanin).

 CTGGGGGGTGTGAACAAACAC               slyšící

CTGGGGG...TGTGAACAAACAC               vada sluchu

Zbylých téměř 30% tvoří jiné typy mutací. Studie P. Seemana a dalších autorů (2004, 2006) určila toto pořadí jednotlivých mutací na GJB2 u českých neslyšících s poruchou GJB2 genu:

  1. 35delG 77.2%
  2. Trp24stop 13.7%
  3. IVS 1+1 G na A 2.9%
  4. 313del14 2.6%
  5. delE120 1.2%

Ostatní mutace mají výskyt menší než 1 %. Velmi zajímavý je poměrně častý výskyt mutace IVS 1+1 G na A. Tato mutace se totiž jako jediná nachází na nekódující části genu GJB2 a obvykle nebývá vyšetřována. Vysvětlila hluchotu u 45% neslyšících, kteří měli zjištěnu pouze jednu mutaci na GJB2, která sama o sobě jejich postižení nevysvětlovala. Toto zjištění může být důležité pro rodiče neslyšících dětí, u kterých se zjistí pouze jedna mutace v obvykle vyšetřované kódující části GJB2.

MŮŽE BÝT SLUCHOVÁ VADA NAŠEHO DÍTĚTE ZPŮSOBENA MUTACEMI GENU CX26?

Hluchota následkem poruchy Cx26 bývá nejčastější u osob, kde:

  1. Sluchové postižení bylo diagnostikováno po porodu, nebo v raném dětství.
  2. Mají těžkou nedoslýchavost, zbytky sluchu nebo praktickou hluchotu.
  3. Nemají žádný další zdravotní problém (nesyndromová vada).
  4. Neexistuje žádná zjevná zevní příčina jejich sluchové vady.

Toto jsou nejčastější charakteristiky lidí s hluchotou způsobenou Cx26, ale existují samozřejmě výjimky. Mutace Cx26 mohou například způsobovat i lehké nebo středně těžké ztráty sluchu.

Právě proto, že sluchová vada způsobená mutacemi genu GJB2 (pro Cx26) může být různě těžká, je důležité testovat mutace genu i v případech, kdy v rodině nikdo jiný nikdy časnou sluchovou vadu neměl, nemuselo se o ní totiž vůbec vědět. Navíc existují případy, kdy byla hluchota dítěte původně připisována vnějším vlivům (infekce, určité typy ototoxických antibiotik) a později se ukázalo, že dítě má mutaci v GJB2 genu. V tom případě je pravděpodobnější, že je sluchová vada způsobena geneticky, než že je získaná. Mnoho ORL lékařů a foniatrů začíná proto doporučovat vyšetření GJB2 genu u většiny dětí se sluchovým postižením.

JAK SE PROVÁDÍ TEST GJB2 GENU?

Je to genetický test, který určí, zda jsou v genu GJB2 nějaké sekvenční změny – změny normálního pořadí bází, tedy jiné řazení základních bází A, C, G, T, než jaké je pro tento gen běžné. K vyšetření stačí vzorek krve nebo i slin. Po přípravě DNA je sekvence GJB2 vyšetřované osoby porovnána s normální sekvencí tohoto genu.

Některé laboratoře vyšetřují celou sekvenci genu GJB2, tedy celou řadu bází, které gen tvoří. Mohli bychom si to představit jako čtení celé stránky v knize ve chvíli, kdy hledáme přehozená nebo chybějící písmenka ve všech slovech. Jiné laboratoře hledají pouze mutaci 35delG, což je nejčastější mutace genu Cx26 v bělošské populaci (kam většina z nás svým původem patří). V tomto případě lze test připodobnit k situaci, kdy na celé stránce cíleně hledáme jenom určité špatně napsané slovo na konkrétním jednom místě (třeba pouze chyby ve svém jméně) a ostatních slov a případných chyb si nevšímáme. Některé laboratoře obě metody kombinují tak, že nejprve hledají nejčastější mutaci 35delG a celý gen sekvenují pouze tehdy, když nejčastější mutaci test neobjeví.

NA CO BYCHOM SE PŘED TESTOVÁNÍM MĚLI PTÁT?

  1. Jaký typ DNA testu GJB2 genu laboratoř provádí? Analyzuje celý gen, nebo pátrá pouze po některých nejčastějších konkrétních mutacích? Rozhodně byste se měli ujistit, že pokud bude test na zjišťování běžných mutací negativní, nebo pokud bude běžná mutace nalezena pouze v jednom z obou genů, provede laboratoř sekvenční analýzu celého genu. Pokud to pracoviště nedělá, může pozornosti uniknout méně obvyklá mutace genu. Důvod, proč některé laboratoře nenabízejí sekvenční analýzu, je technický, finanční nebo časový.
  2. Za jak dlouho bude znám výsledek? Zeptejte se na časový horizont dříve, než půjdete na odběr krve.
  3. Kolik test stojí? V Čechách je test GJB2 genu, pokud ho doporučí odborný lékař, hrazen plně zdravotními pojišťovnami.

JAK INTERPRETOVAT VÝSLEDKY TESTU?

Jsou tři možné výsledky testu GJB2 genu:

  1. Byly nalezeny 2 mutace. Pokud byly objeveny dvě identické (35delG/35delG) nebo dvě odlišné (35delG/167delT) mutace, lze předpokládat, že sluchová vada je způsobena mutací genu GJB2 (pro Cx26).
  2. Nebyla nalezena ani jedna mutace GJB2 genu (pro Cx26). Pokud nebyla nalezena žádná mutace, musíme se nejprve ptát, jaký typ testu byl proveden. Byl sekvenován celý gen, nebo se hledaly pouze obvyklé mutace? Pokud byla prozkoumána celá sekvence genu a nebyla nalezena žádná mutace, příčinou sluchové vady pravděpodobně není porucha genu GJB2.
  3. Byla objevena pouze jedna mutace (35delG/-). V tomto případě je interpretace testu nejkomplikovanější. Nejpravděpodobnější vysvětlení jsou následující:

3A/ Nalezená mutace GJB2 nemá žádnou souvislost se sluchovou vadou. Tyto mutace jsou v populaci slyšících lidí obvyklé, zhruba každý třicátý člověk má ve své genetické informaci jednu recesivní, tedy neprojevenou mutaci GJB2, která nijak neovlivňuje jeho slyšení. Proto i neslyšící člověk může být náhodným nosičem této mutace. V tom případě je jeho sluchová vada způsobena mutací na jiném genu, nebo jinou, negenetickou příčinou.

3B/ Test druhou mutaci nedetekoval, ačkoliv je v genu přítomna. Pak se musíte ptát, zda laboratoř testovala celý gen GJB2 sekvenčně, nebo zda pátrala pouze po obvyklých typech mutací. Pokud nebyl gen testován celý sekvenčně, měli byste test doplnit na pracovišti, které celou sekvenční analýzu provede. Pokud i po ní nebude nalezena druhá mutace genu, může se stále ještě jednat o poruchu genu pro Cx26. V některých případech může být totiž druhá mutace v oblasti genu, která nekóduje proteiny, a proto tyto oblasti laboratoře nevyšetřují, přesto se v důsledku může projevit sluchová vada. Takovou mutací v nekódující oblasti GJB2 je třeba IVS 1+1 G na A, o které jsme již mluvili v rámečku o různých typech mutací GJB2. Existují však asi i další mutace, které dosud neznáme, a proto se u malého procenta neslyšících nemusí příčina sluchové poruchy v GJB2 genu spolehlivě objasnit.

3C/ Mutace může být dominantní. Ačkoli mutace Cx26 jsou obvykle recesivní, jsou známy nejméně 4 mutace GJB2, které se projevují jako dominantní. To znamená, že stačí pouze jedna mutace k tomu, aby se manifestovala v podobě sluchové vady. Pokud ovšem jediná zjištěná mutace patří mezi ty, které jsou známy jako recesivní, pravděpodobně nebude primární příčinou hluchoty. Je důležité mít na paměti, že určitě existují mutace GJB2, které dosud nebyly vůbec popsány a o nichž tedy ani není známo, zda působí škodlivě nebo nejsou škodlivé a zda působí dominantně nebo recesivně.

                                                                                                                                ilustrační foto/Shuterstock

MŮŽE MÍT NOSIČ MUTACE GJB2 GENU VADU SLUCHU?

Člověk, který má ve své genetické informaci jednu recesivní mutaci, se nazývá nosič, nebo heterozygot. Podle dostupných studií nejsou heterozygoti sami mutací nijak zásadně ovlivněni, ale již víme, že ji mohou přenést do genetické informace svých dětí. Některé studie ukazují, že i heterozygoti mohou mít velmi lehkou vadu sluchu. Možné je i to, že heterozygoti pro Cx26 jsou náchylnější k horšení sluchu způsobeného věkem. Zatím pro to však neexistuje jasný důkaz. Možným vysvětlením by mohlo být, že jeden funkční gen GJB2 zajišťuje tvorbu connexinu 26, ale ne v množství, v jakém jej produkují dva funkční geny GJB2.

Zajímavou studii v Čechách dělal Syka a kol. (2008) Testovali velmi detailně sluch u 34 heterozygotů mutace 35delG v GJB2 a porovnávali jejich audiogram s kontrolní skupinou. U skupiny heterozygotů zjistili statisticky významně horší prahy sluchu, rozdíl byl výraznější u žen a svého maxima – 10 dB – dosahoval na frekvenci 10 000 Hz. Prakticky to ovšem znamená pouze nepatrné zhoršení sluchu na frekvenci, která je mimo frekvenční oblast mluvené řeči (125 Hz – 8000 Hz).

MÁME DÍTĚ SE SLUCHOVÝM POSTIŽENÍM A OBA JSME NOSIČI MUTACE CX26. CO TO ZNAMENÁ PRO NAŠE BUDOUCÍ DĚTI?

Každé vaše další dítě bude s 25% pravděpodobností také hůře slyšet. Na druhou stranu si můžete být téměř jisti, že sluchová vada dítěte není spojena s žádnými dalšími zdravotními komplikacemi, děti s poruchou genu GJB2 jsou ve všech ohledech zcela zdravé a šikovné. Pokud nebudete při plánování dalších dětí ochotni toto čtvrtinové riziko sluchové vady podstoupit, můžete se pokusit o umělé oplodnění, při kterém se z oplodněných zárodků po genetickém testování vybere ten, který nenese mutaci genu GJB2.

ZÁVISÍ VELIKOST SLUCHOVÉ ZTRÁTY NA TYPU MUTACE?

Jednotlivé mutace v GJB2 se dělí podle velikosti svého vlivu na tvorbu a funkci connexinu 26 na inaktivující a neinaktivující. Inaktivující mutace zcela nebo téměř zcela znemožní produkci proteinu, neinaktivující ji omezí jen částečně nebo ovlivní negativně funkci proteinu. Všech nejčastějších 5 mutací v české populaci patří mezi inaktivující mutace, tedy ty, které tvorbu connexinu 26 zásadně ovlivňují.

Protože každý homozygot musí mít dvě mutace GJB2 genu, je velice zajímavé sledovat souvislost mezi jednotlivými kombinacemi mutací a velikostí ztráty sluchu. Reprezentativní studii na toto téma udělal Snoeckx a kol. (2005). Získal audiometrické údaje a výsledky DNA testů GJB2 genu od 1531 (!) sluchově postižených pacientů se 2 mutacemi GJB2 genu z celého světa, včetně České republiky.

Audiometrické údaje byly ve většině případů získány subjektivní audiometrií, v 8% behaviorálními metodami a v 1.5% metodou SSEP. Základem pro rozdělení do audiologických kategorií byla průměrná prahová hodnota sluchu měřená na každém uchu zvlášť na frekvencích 500, 1000 a 2000 Hz, tedy aritmetický průměr ze 6 hodnot.

21-40 dB: lehká nedoslýchavost

41-70 dB: střední nedoslýchavost

71-95 dB: těžká nedoslýchavost

nad 95 dB: zbytky sluchu

Výsledky studie pro základní kombinace mutací vypadají takto:

0% 20% 40% 60% 80% 100% inakt./inakt. inakt./neinakt. neinakt./neinakt. lehká n. střední n. těžká n. zbytky

Kombinace dvou inaktivujících mutací, v české populaci typicky 35delG/35delG, vede k výrazně vyšší pravděpodobnosti velmi těžkého poškození sluchu – 64%. Na druhou stranu má 36% lidí s touto kombinací ztráty sluchu v průměru menší než 95 dB, tedy dobře nebo přinejmenším částečně využitelné pro kompenzaci sluchadly. V 11 % je ztráta sluchu s kvalitními sluchadly výborně kompenzovatelná.

U kombinací inaktivující/neinaktivující mutace neinaktivující/neinaktivující mutace je výrazně nižší pravděpodobnost těžkých ztrát sluchu,   nadpolovičním počtu případů mají tito lidé pouze střední nebo lehkou nedoslýchavost.

                                                                                                                               ilustrační foto/Shutterstock

ZÁVĚR

Vědecký pokrok posledních desetiletí zásadním způsobem objasnil příčiny velkého procenta sluchových vad u malých dětí. Podstatně se zlepšily i možnosti jejich následné kompenzace, kvalita digitálních sluchadel poslední generace je nesrovnatelná s tzv. krabičkovým sluchadlem, které bylo u malých dětí běžné ještě před dvaceti lety. Objevily se kochleární implantáty, které dokáží kompenzovat nejtěžší sluchové vady. Vědecký vývoj nepřinesl ovšem jen odpovědi a řešení, ale otevřel i mnoho nových otázek, často etického charakteru:

Chceme si pořídit další dítě, když prvorozené má connexinovou vadu sluchu? Máme se pokusit o umělé oplodnění se selekcí zárodků? Co když by přirozeně počaté dítě mělo lehčí vadu, než má náš prvorozený? Opravňuje nás vůbec riziko sluchové vady k takovým otázkám? Je kombinace dvou inaktivujících mutací (typicky v Čechách 35delG/35delG) dostačujícím důvodem k rychlé kochleární implantaci? Co když je dítě mezi těmi 36 procenty, jejichž vadu lze kompenzovat kvalitními sluchadly?

Najít odpověď na tyto otázky je mnohem obtížnější, než řešení vědeckých problémů. Týká se konkrétních dětí a jejich osudů. Nikdy si nemůžeme být úplně jisti, že naše odpověď byla nakonec ta nejlepší, některá rozhodnutí už nelze zvrátit. Při rozhodování nám může pomáhat intuice, zdravý rozum, důvěrná znalost dítěte a také důkladná znalost problematiky, bez níž nemůže mít naše rozhodnutí tolik potřebný racionální základ. Právě k ní by chtěl tento text přispět.

Následující dvě kazuistiky ukazují, jak složitý a dlouhotrvající může být proces zpřesnění velikosti sluchové vady u malých dětí. Vyplývá z nich, že ani pozitivní genetická zátěž ani objektivní metody vyšetřování sluchu nemusí být v tomto procesu vždy tím nejlepším vodítkem. Tím je především opakované a pečlivé sledování dítěte v jeho přirozeném prostředí.

Rodina z Českých Budějovic:

Madlenka se narodila v lednu 2005. Její o osm let starší bratr má těžkou nedoslýchavost kompenzovanou sluchadly. První genetické vyšetření u něj neobjevilo žádnou genetickou poruchu, o tři roky později doplňkové genetické vyšetření potvrdilo mutaci genu pro connexin 26. U Madlenky jsme tedy počítali s 25% rizikem postižení sluchu. Asi 12 hodin po jejím narození byla vyšetřena screeningovým vyšetřením otoakustických emisí (OAE). Emise byly nepřítomné, mohli jsme tedy předpokládat, že holčička má ztrátu sluchu větší než 30 dB. Po 9 týdnech proběhlo vyšetření BERA, které nedopadlo příliš optimisticky, vlevo ztráty cca 65-75 dB, vpravo 55-65 dB. O dva týdny později výsledky potvrdilo vyšetření SSEP v Praze – vlevo 80-80-60-90, vpravo 70-55-60-80 dB. Prakticky celou dobu jsme měli z chování Madlenky jiný dojem. Hezky reagovala na hlas, dala se utišit v noci. Ve srovnání se synem propastný rozdíl. Proto jsme se sami objednali na kontrolní vyšetření v nemocnici v Hradci Králové, kde o měsíc později došli k jiným výsledkům – lehká nedoslýchavost, vzhledem k nízkému věku při vyšetření je možné, že slyší v normě. O další měsíc později, když bylo Madlence 6 měsíců, dorazila zpráva z genetiky, že u ní nebyla prokázána mutace 35delG ani žádná jiná odchylka v kódující sekvenci Cx26 genu.

Rodina z Prahy:

Kubíček se narodil v září 2009. Jeho o devět let straší bratr, který je těžce nedoslýchavý a bez sluchadel téměř nic neslyší (vpravo těžká nedoslýchavost 80-90-80-75 dB, vlevo zbytky sluchu 100-110-105-100dB), zdědil po slyšících rodičích dvě různé patogenní mutace genu GJB2 (je tedy složený heterozygot pro mutace 35delG a delE120   Cx26 genu).

Protože jsme o Kubovi věděli již z vyšetření plodové vody, že je na tom po této stránce genetické výbavy zcela stejně, přistupovali jsme k němu od jeho narození jako k sluchově postiženému miminku. Protože v době vyšetření staršího bratra se předpokládalo, že všichni nositelé mutace Cx26 mají střední až těžkou vadu sluchu, považovali bychom za štěstí, kdyby na tom Kuba se sluchem nebyl hůře než jeho bráška. V každém případě jsme chtěli co nejdříve znát skutečnost a zajistit mu adekvátní komunikaci a kompenzaci, což se u jeho staršího bratra povedlo bohužel až po 1,5 roce od objednání na foniatrii (tedy v jeho dvou letech).

Kuba byl jako každé dítě narozené v pražském Podolí (Ústav pro péči o matku a dítě) 5. den po narození vyšetřen screeningovým vyšetřením otoakustických emisí (OAE). Emise byly nepřítomné, což nasvědčuje ztrátě sluchu větší než 30 dB. Odpověď byla nediferencovaná při 30 a 50 dB i při vyšetření metodou sluchových kmenových evokovaných potenciálů (BAEP). Zde vycházely odpovědi oboustranně až při 70 dB.

Ve 3 měsících byl Kuba vyšetřen detailněji metodou SSEP (vlevo 40-30-40-40 dB, vpravo 40-40-50-60 dB) a o 2 měsíce později přišlo ještě další doplňkové vyšetření BERA, které dopadlo ještě optimističtěji: pravděpodobně lehká nedoslýchavost. Na zvuky Kuba zprvu nepříliš reagoval, ale přesto se hlavně v posledním kvartálu jeho prvního roku jevil velký rozdíl v reakci na hlas oproti bratrovi. Samozřejmě dále testujeme jeho sluchové reakce, v této chvíli se nám například nejeví stoprocentní směrovost slyšení. Nicméně teď v jednom roce Jakub pěkně a srozumitelně opakuje i sám používá několik prvních slov (cca 30), v noci ho lze ukolébat hlasem i nechtěně probudit, zajímá se o zvuky a pohupuje se podle melodie. Sluchadla jsme zatím odložili do šuplíku, uvidíme, jak se Kubova řeč bude dále vyvíjet.

 

Zpracovala Iva Jungwirthová

Autorka článku pracuje v Rané péči Čechy CDS Tamtam v Praze.

inzerce
Úvodník

Vážené čtenářky, vážení čtenáři,

je všeobecně známo, že včasná diagnostika je základním předpokladem pro úspěšnou kompenzaci a rehabilitaci sluchové vady a předurčuje tak celkový vývoj dítěte. Proč se tedy stále setkáváme s příběhy rodičů, kteří museli v dlouhém a složitém období, plném nejistoty, pátrat po tom, co vlastně ve vývoji jejich dítěte není v pořádku? Je nutné, aby do života rodičů zasahovaly i tyto pocity? „Těžko se srovnávám hlavně s tím, že jsme na vadu sluchu přišli tak pozdě.Přemýšlím, kolik křivd jsme na něm napáchali, když jsme si mysleli, že zlobí, že neposlouchá, přitom dnes už vím, že kolikrát neslyšel, nerozuměl, nevěděl, co jsme po něm chtěli. S tím se mi těžko smiřuje,“ vysvětluje jedna z maminek, které se redakci časopisu Dětský sluch svěřily se svou složitou rodičovskou zkušeností. Třetí letošní číslo tištěného magazínu Dětský sluch, které vyšlo v polovině září, jsme věnovali právě včasné diagnostice. Část textů z tohoto vydání budeme postupně publikovat i zde na portálu.

Zkušenosti ze zahraničí prokazatelně dokládají efektivitu funkčních národních screeningových systémů v jiných zemích, že i naše regionální a lokální zkušenosti v České republice mají pozitivní a statisticky významné výsledky, jak potvrzují lékařky Zuzana Šálková a Eva Havlíková. Také Tamtam se od roku 1998 snaží podporovat proces zavedení celoplošného screeningu sluchových vad v České republice, jak se můžete dočíst v článcích Věry Pažourkové, Anny Kučerové a Anny Jiříčkové. Kontinuálně sledujeme, že mezi našimi klienty přibývá dětí, které mají ve čtyřech měsících kvalitní sluchadlo a rodiče, kteří vědí, jak sluch a komunikaci svého dítěte rozvíjet. Bohužel ale registrujeme i rodiče, a není jich málo, kteří o vyšetření sluchu v porodnici vůbec nevědí, nebo naopak vyšetřením projdou, ale netuší, co mají dělat dál. Mnozí ještě ve dvou letech věku dítěte žijí s informací, že jejich dítě je opožděné. Proč nemohou být vyšetřeni novorozenci ve všech porodnicích? Proč nemohou dostat všichni rodiče srovnatelné informace? Proč nemáme v České republice jednotné metodické vedení a národní registr? Bude se systém u nás nějak měnit? Co můžeme pro pozitivní změnu udělat? Odpovědi na tyto a další otázky najdete v posledním čísle Dětského sluchu a na portálu www.idetskysluch.cz.

Díky mnoha zapáleným (vytrvalým,nadšeným, obětavým) lidem, jmenovitě musím vzpomenout na pana docenta Zdeňka Kabelku, jsme na správné cestě a nikoli jen na jejím začátku. Věřím, že každý krok správným směrem je užitečný a jsem přesvědčena, že dobré věci poslouží i toto číslo Dětského sluchu a veškeré informace na portálu idetskysluch.cz věnované včasné diagnostice.

 

Příjemné a inspirativní čtení vám přeje

Mgr. Jana Fenclová
ředitelka CDS Tamtam o.p.s.

Sociální sítě

Zůstaňte se námi v kontaktu díky našim sociálním sítím! Inspirujte se, ptejte se odborníků!

Facebook
Nejnovější trendy a aktuality
YouTube kanál
Zajímavé reportáže a rozhovory
Partneři
Partneři-2 Partneři-4 cez 4 malý sirda úřad vlády 2
inzerce
Copyright © 2015-2018 Centrum pro dětský sluch Tamtam, o.p.s. se sídlem Hábova 1571/22, 155 00 Praha 5 – Stodůlky IČ: 00499811. Jakékoliv užití obsahu včetně převzetí, šíření či dalšího zpřístupňování článků a fotografií je bez souhlasu Centrum pro dětský sluch Tamtam, o.p.s., zakázáno.